patmucock patmucock
  • 01-03-2015
  • Mathematics
contestada

a number increased by 10 is 114

Respuesta :

Аноним Аноним
  • 01-03-2015
a number increased by 10 is 114 answer 104

Answer Link
Аноним Аноним
  • 01-03-2015
104 plus 10 equals 114
Answer Link

Otras preguntas

Please help solve, thanks in advance!
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
define concentric circles
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
How do I do trebuchet calculations????? Help me please
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
Compliant is to stubborn as excited is to
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5