SeNpaChi SeNpaChi

02-05-2020
Mathematics

contestada

Simplify so that there are only positive exponents (3^9/3^-5)

Respuesta :

wegnerkolmp2741o wegnerkolmp2741o

02-05-2020

Answer:

3^14

Step-by-step explanation:

(3^9/3^-5)

We know that when we have a^b / a^c = a^(b-c)

3^(9 - -5)

3^(9+5)

3^14

Answer Link

Otras preguntas

can anyone help me to solve these 2 questions please I need very clear steps !!!!

With this sole proprietorship, who pays the taxes?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Why did North Carolina and South Carolina split into two colonies? A. They had different beliefs about slavery. B. They had large groups of competin

Which phrase best describes the New World Order?

1. Read the paragraph below. When Tyrese dropped his crutches and limped to the starting block, the audience froze. Then the starter’s signal sounded, and the s

Cuanto es (2x+2y=20) (-2x-6y=-52) con método de igualación y método de suma y resta

What is the solution to the following equation? 5(2x − 14) + 23 = 7x − 14 11 14 30 36

Sugar melts at 367°F. What is the melting point of sugar on the Celsius scale?

The substance in the digestive system that lubricates moistens and protects the surface of the lumen is