video4all video4all
  • 04-03-2021
  • Biology
contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult
  • 04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

Which interpretation is a possible theme of ovids
An animal without a backbone is known as a(an) _____. vertebrate hermaphrodite polyp invertebrate
Who is a Postmodern author? UPDATE: ITS A.TRUMAN CAPOTEA. Truman Capote B. Nathaniel Hawthorne C. Ernest Hemingway D. Edgar Allan Poe
What individual used religion as an argument against slave labor
What is the domain of the function in this table?
How much was $500 invested at 6% interest compounded monthly be worth after four years
Can anyone help check if my calculation is correct or wrong?
Please help me ASAP thanks !!
Find the focus of the conic section defined by 12x+y^2-14y+1=0
A water pitcher weighs 1.72 kg when empty and 2.01 kg when filled with water. How much does the water weigh?