MiaHamm900 MiaHamm900

01-02-2017
Mathematics

contestada

true or false
the lcm of 2 numbers is the product of 2 numbers

Respuesta :

Аноним Аноним

01-02-2017

false, that is not correct

Answer Link

Otras preguntas

When citizens _______, they help elect people who carry out government tasks. A. vote B. volunteer C. lobby D. nominate

The substance in the digestive system that lubricates moistens and protects the surface of the lumen is

Which country use tax brackets as part of their tax system? canada australia south africa all of the above?

from what you have heard about modern war

What is the slope of the line that contains the points (10,-3) and (8,-9)?

Adair needs $21,150 to purchase a boat. How much money will you need to invest today in a savings account earning 3.2% interest, compounded monthly, to have en

What are some examples of dramatic irony in The Hobbit?

HELP NEEDED !!!! A class's exam scores are normally distributed. If the average score is 65 and the standard deviation is 6, what percentage of students scored

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

3m2+7=55 answer please