emster128
emster128 emster128
  • 02-03-2017
  • Mathematics
contestada

Prove that for every two positive integers a and b that
\((a+b)(\frac{1}{a}+\frac{1}{b}) > or = 4\)

Respuesta :

SyntaxError
SyntaxError SyntaxError
  • 02-03-2017
[tex]\((a+b)(\frac{1}{a}+\frac{1}{b}) \ \textgreater \ or = 4\) \\ 1+a/b+b/a + 1 \geq 4 [/tex][tex]\((a+b)(\frac{1}{a}+\frac{1}{b}) \ \textgreater \ or = 4\) [/tex]

distributed 

choose 1 as your lowest positive integer

plug 1 into a and b

1 + 1 + 1 + 1[tex] \geq 4[/tex]

Answer Link

Otras preguntas

Which geographic characteristics makes Washington such an important state for international trade? A. It's distance from Canada and Mexico B. It's location on t
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
While speaking with cassius, what military action does brutus want to take?
How many positive odd integers less than 300 can be formed using the digits 0, 1,2,3,4?
If two populations are isolated, they may become separate species because they are not longer ________.
If 100 kg of cucumbers are 99% water, how much do they weigh if they are 97% water?
what is the theoretical probability of picking a diamond from a standard deck of car
What is the difference in elevation between a plane flying at 25,500 ft above sea level and a submarine traveling 450 ft below sea level?
I=$310 P==$1,000 t=5 years
A teratogen is any agent or condition that increases the risk for: select one: a. prenatal abnormalities. b. damage to the placenta. c. extra chromosomes. d. ma