pjnerd1337 pjnerd1337

01-03-2024
Computers and Technology

contestada

What are the advantages of broadcasting data in Ethernet?

Respuesta :

cjpardo111 cjpardo111

01-03-2024

The main advantage of broadcasting data in Ethernet is that it simplifies communication, thereby lowering costs in LANs.

Answer Link

Otras preguntas

How did new industrial technologies influence the course of world war i?

The the flourishing of a vibrant black culture in the 1920s in new york city, called _____, was inspired by countee cullen, langston hughes, and claude mckay.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which of the following are considered irregular verbs? Poner and lavar Poner and hacer Bañar and poner Lavar and hacer

Which constitutional amendment allowed voting for citizens who were eighteen or older?

Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged

the members of an animal community are usually similar in

Your religious identity is only important for you within your family and does not matter in the public sphere.

Monocytes are a type of white blood cell that can differentiate into what two cells?

need help anybody know how to do this