Seudónimo
Seudónimo
01-12-2015
Mathematics
contestada
Is y=2x-5 a function?
Respuesta :
AL2006
AL2006
01-12-2015
Yes it is.
It says ...
"Whatever number anybody drops into the funnel on top,
double the number, then subtract 5, then turn the crank
and drop the result out the bottom."
Answer Link
VER TODAS LAS RESPUESTAS ( 57+ )
Otras preguntas
When a molecule can best be represented as a series of resonance forms, each of these forms always contributes to the same degree in the hybrid?
A string of lights contains three lights. the lights are wired in series, so that if any light fails the whole string will go dark. each light has probability .
PLEASE!!!!!!!!!! HELP NEEDED QUICKA state offers two lottery games, WinOne and PlayBall. Both games cost $2 per ticket. -In WinOne, the player picks a single
Which pair of verbs best completes this informal imperative sentence? ________ y _________ todo sin límite. Beba, coma Bebe, come Bebemos, comemos Bebis
The sterile material that is placed directly on a wound is termed the:
When did Christianity become the official religion for the Roman Empire
For the right triangle with side of lengths 5 12 and 13, find the length of the radius of the inscribed circle
Given that A=xy find the percentage increase in A when both X and Y increase by 10%
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
At a fast food restaurant, four friends each ordered a sandwich for $4.89 each and a drink for $1.69. What is the best estimate of the amount of change they wil
